Introduction
Banana is a renowned and the most consumed staple
fruit on the planet, especially in Pakistan. It is grown in more than 90
countries mainly in Brazil, Ecuador, North-America, Japan, Philippines,
Colombia, China, India and Costa Rica (Varma and
Bebber 2019). In Pakistan, the area under its cultivation is 352
thousand ha with an average yield of 31.4 MT ha-1
(Rehman et
al. 2018). With an
increase in urbanization, it is becoming an important cash crop serving as the
sole income source to the poor farmers to eliminate the poverty (Memon et al. 2016). The fruit is usually curved with a soft flesh rich in starch covered
with an enhanced variation of rind which may be brown, green, purple, red, or
yellow when ripe (Fu et al. 2018). It is a rich source of nutritional
antioxidants including potassium, manganese and vitamin B and C. Banana consumption plays a major role on human health in reducing the risk of colorectal cancer, asthma,
diabetes, leukemia, high blood pressure and cardiovascular diseases (Ghag and Ganapathi 2018).
Being a perishable fruit, its
commercial production is severely affected by post-harvest losses up to 4045%
due to improper handling, inadequate harvest, lack of proper packing skills,
insufficient storage conditions and many other uncontrolled factors (Selvaraj et al. 2019). Banana plant is attacked by a number of fungal pathogens namely Fusarium roseum, Botryodiplodia
theobromae,
Fusarium semitectium, Fusarium moniliformae, Colletotrichum
musae, Lasiodiplodiat heobromae, Verticillium theobromae and Trachysphaera
fructigena causing
blossom end rot, cigar-end rot, Fusarium wilt, crown rot and anthracnose
disease (Kuyu and Tola 2018; Shen et al. 2018; Vilaplana et al. 2018). The genus Curvularia is comprised of more than 75 species, most of them
are facultative plant pathogens responsible for pre-harvest and post-harvest
yield loses in economically important crop plants (Bengyella et al. 2019). Curvularia lunata is one of the most destructive
ubiquitous pathogens responsible for stem blight, leaf spot, leaf blight, root
rot and necrotic rot in rice, spinach, strawberry and switchgrass (Gupta et al. 2017; Bisht et al. 2018; Liu et al. 2019). The accurate identification of C. lunata has
been very confusing because of morphological similarities among the culture
isolates depending upon the growing conditions making it doubtful, incorrect or
remains unresolved (Kusai et al. 2016). Recent studies have shown the
importance of molecular identification as these do not correlate with
morphological identification. Molecular studies by using the polymerase chain
reaction and DNA probes are gaining importance worldwide for the rapid and
specific detection of C. lunata for ensuring the quality of fruits,
vegetables and cereals (Santos et al. 2018; Lu
et
al. 2019).
The objective of the present study was to identify the post-harvest pathogen of
banana rot in Pakistan through morphological and molecular characters.
Materials and Methods
Sample collection and identification
Banana with greenish grey to dark green, dry, sunken
and decayed lesions of rot were collected from the local market of Lahore,
Pakistan. Diseased portions were surface sterilized in sodium hypochlorite (3%)
for 1 min with three subsequent washings with distilled water and placed on
malt extract agar (MEA) containing plates for 5 days. After that, pure culture
was obtained by placing the young fungal mycelia, obtained from the colony
margins, and incubated at 28°C for 7 days. The mature fungal colony was
identified on the basis of its macroscopic features (colony size, shape,
texture, exudates and color) and then examined through microscopic
characteristics (conidia and conidiophores) under a light microscope at 4, 10,
40 and 100X magnifications.
Scanning electron microscopic (SEM) analysis
Seven-day-old
C. lunata culture was processed according to
Jinfeng et al. (2017) with some modifications before SEM analysis. The sample was
cut into 1 cm3 pieces and placed in vials
containing 4% glutaric dialdehyde followed by three washings in 0.1 M cacodylic sodium trihydrate buffer.
Next, the samples were fixed in osmium tetraoxide (1%) for 1 h and washed again
with the sodium trihydrate buffer with a subsequent dehydration process in pure
ethanol and then passed through acetone. The sample was then placed on a stub
for further analysis under electron microscope (Jeol JSM-6480 LV).
Molecular characterization
The genomic DNA of C. lunata was
isolated by using CTAB method (Doyle and
Doyle 1990) and run PCR with ITS and GAPDH primers
given in Table 1. Amplified products were subjected to MiSeq Illumina
sequencing, USA and submitted to NCBI (National Center for Biotechnology
Information) database for BLAST search tool to perform the homology comparisons
with other isolated sequences of C. lunata by
using Clustal W software (Thompson et al. 1994). On the basis of aligned sequence data, a neighbour-joining tree was constructed by using MEGA X software (Tamura et al.
2012).
Pathogenicity test
For the confirmation of C. lunata attack on banana fruit, a pathogenicity test was performed on five
surface sterilized banana fruits. The fruits were inoculated by using an
inoculation needle carrying fresh mycelia of C. lunata grown on MEA. Fruits in control treatment were
inoculated with sterile MEA and placed in autoclaved beakers for 7 days. After
the confirmation of pathogen establishment, the C. lunata conidia were re-isolated from the lesions developed on
banana and their morphological characters were studied.
Results
Morphological identification revealed that the fungal
colonies were fast growing on malt extract agar with an average diameter of 8
cm in 7 days of inoculation at 28°C. The young colony was greenish grey in
color which upon maturation turned into downy dark grey to black with a
blackish grey reverse on MEA (Fig. 1). The microscopic examination of the
fungal growth revealed that the conidia were single or in the form of chains
attached with brown geniculate conidiophores distinguishes by septation with dark brown scars. The apical part of
conidiophores was flexuous to straight, unbranched and septate. The mature
conidia were 19.8 to 27.3 Χ 7.3 to 11.8 ΅m in size, distinctly curved at subterminal ends,
ellipsoidal with rounded ends, dark brown to reddish brown in color with smooth
conidial walls having 3 oblique septa.
All the inoculated banana fruits
showed rot symptoms after 7 days of inoculation (Fig. 2). Initially, small
sized dark green sunken lesions appeared on the banana surface which later on
expanded by joining together. The fungal pathogen was re-isolated from the
infected banana fruits on MEA plates producing the same characteristic
features.
The genomic DNA of C. lunata was amplified by using two sets of primer pairs viz., ITS and GAPDH generated single fragment PCR products shown in Fig. 3,
with MN752153 and MN787829 accession numbers, respectively, resulted in 100%
identity match. The obtained sequences were aligned by constructing a phylogenetic
tree with each of the individual primer ITS (Fig. 4A) and GAPDH (Fig. 4B) by
using a neighbor-joining method in MEGA X software.
Discussion
Table 1: List of oligonucleotide primers used for the
characterization of C. lunata at molecular level
Primer name |
5΄ to 3΄ sequence |
Amplicon size (bp) |
Annealing temperature |
ITS 1 Forward |
TCCGTAGGTGAACCTGCGG |
~637 |
60°C |
ITS 4 Reverse |
TCCTCCGCTTATTGATATGC |
||
GAPDH Forward |
CAACGGCTTCGGTCGCATTG |
~561 |
60°C |
GAPDH Reverse |
GCCAAGCAGTTGGTTGTG |
Fig. 1: (A)- Mature colony of Curvularia lunata on MEA, (B)- Colony reverse on MEA, (C)- Conidia
at 4X, (D)- Conidia at 10X, (E & F)- Conidia at 40X, (G)- Conidia
at 100X, (H & I)- Conidia under scanning electron microscope showing
conidiophores bearing conidia separately and/or in chains
Fig. 2: Pathogenicity test.
(A)- Symptoms of rot in naturally diseased banana, (B)- Control banana (no
inoculation) which is symptomless, (C-G)- Typical symptoms of Curvularia lunata after inoculation on
banana
Fig. 3: Agarose gel electrophoresis, (M): 1 kb DNA standard marker, (1):
Genomic DNA of Curvularia lunata, (2):
ITS1/ITS4 amplified PCR product, (3): GAPDHf/GAPDHr amplified PCR product
Fig. 4: The ITS (A) and GAPDH (B) gene
sequences of the C. lunata isolate from this study was aligned with C. lunata sequence isolates from GenBank using Clustal W© program.
The phylogenetic trees were constructed using the neighbor-joining method in
MEGA X version 10.1 (Tamura et al. 2012)
Major fungi associated with rot decay are Curvularia lunata, C. verruculosa, C. tuberculate, C. brachyspora, C. clavata, C. trifolii, C. coicis, C. inaequalis and C. spicifera (Pei et al. 2018; Pornsuriya et al. 2018; Wang et al. 2019; Balamurugan et al. 2020). Among them, C. lunata, the dematiaceous mold is considered as the most
virulent strain responsible for fruit rot in Carica papaya, Ziziphus
mauritiana,
Solanum lycopersicum, Fragaria ananassa, Hylocereus polyrhizus, Malus pumelo, Mangifera
indica,
Phoenix dactylifera and Citrus sinensis on a large scale (Bussaban
et
al. 2017; Bisht et al. 2018; Helal et al. 2018; Majumdar and Mandal 2019). Similarly, in the present study, the pathogenicity test with C. lunata revealed that it is the most pathogenic isolate also
capable of inducing rot on banana fruit.
According to Santos et al. (2018) pathogen accuracy on the basis
of morphological and microscopic characteristics alone poses a diagnostic
dilemma because of the absence or infrequent morphological patterns of conidia
and conidiophores. In such critical situations, molecular methods provide a
great assistance towards their accuracy (Edgar
2018). There are many efforts in this regard to develop such molecular
tools for the accurate identification of the pathogens. Wurzbacher et al. (2019) reported that ribosomal DNA of C. lunatais
composed of internal transcribed spacer (ITS) region with major 18S, 5.8S and
28S transcripts. The ITS region is the best DNA marker with high amplification
success rate widely used in molecular taxonomy because of elevated variations
to differentiate the fungal isolates at inter or intraspecies level (Badotti et al. 2017). In addition, the use of some other secondary DNA markers such as
GAPDH is essential for better speciation process within the genus Curvularia (Kiss et al. 2020). The reason for selecting
glyceraldehyde-3-phosphate dehydrogenase region specifically was that it is
highly constitutively expressed in Curvularia
species making it a successful heterogenous gene for the best screening
experiments (Silva et al. 2017). In previous studies, molecular test
with ITS and GAPDH primers were generally used for the
confirmation of C. lunata (Zhang et al. 2017; Xu et al. 2018; Liu et al. 2019). These markers have also been used
for identification of species in many other genera including Alternaria, Aspergillus, Fusarium,
Wallemia, Colletotrichum, Pythium, Botrytis,
Cochliobolus and Ramularia (Moslemi et al. 2017; Garfinkel and
Chastagner 2019; Janbozorgi et al. 2019; Raza et al. 2019).
Conclusion
On the basis of rDNA sequence of C. lunata with the corresponding amplified DNA products,
morphological, microscopic and molecular phylogenetic results, we believe that C. lunata is the first report of banana rot in Pakistan.
Author Contributions
IHK did experimental work and wrote part of paper. AJ supervised
the work and also wrote a part of the paper.
References
Badotti
F, FSD Oliveira, CF Garcia, ABM Vaz, PLC Fonseca, LA Nahum, A
Goes-Neto (2017). Effectiveness of ITS and sub-regions as DNA
barcode markers for the identification of Basidiomycota (fungi). BMC Microbiol 17; Article 42
Balamurugan
A, K Sakthivel, A Kumar, M Muthamilan (2020). First report of Curvularia hominis inciting fruit rot of
ridge gourd (Luffa acutangula) in Tamil Nadu, India. J
Plant Pathol
102:529529
Bengyella
L, S Iftikhar, K Nawaz, DJ Fonmboh, EL Yekwa, RC Jones, R Roy (2019).
Biotechnological application of endophytic filamentous bipolaris
and curvularia: A review on bioeconomy impact. World
J Microbiol Biotechnol 35:69
Bisht S, R Balodi, A Ghatak, P Kumar (2018).
Determination of susceptible growth stage and efficacy of fungicidal management
of Curvularia leaf spot of maize caused by Curvularia
lunata (Wakker) Boedijn. Maydica
61:59
Bussaban B, P Kodchasee, S Apinyanuwat, C Kosawang, N
Jonglaekha (2017). First
report of Curvularia lunata causing leaf blight on mulberry (Morus
spp.) in Thailand. Plant Dis 101:19511951
Doyle
JJ, JL Doyle (1990). Isolation of plant DNA from fresh
tissue. Focus 12:3940
Edgar
RC (2018). Accuracy of taxonomy prediction for 16S rRNA and
fungal ITS sequences. Peer J 6; Article e4652
Fu
X, S Cheng, Y Liao, B Huang, B Du, W Zeng, Z Yang (2018). Comparative
analysis of pigments in red and yellow banana fruit. Food
Chem 239:10091018
Garfinkel
AR, GA Chastagner (2019). Survey reveals a broad range of fungal pathogens and
an oomycete on peonies in the United States. Plant
Health Prog
20:250254
Ghag SB, TR Ganapathi
(2018). Banana and plantains: Improvement, nutrition, and health. In: Bioactive
Molecules in Food. Reference Series in Phytochemistry. Mιrillon JM, K Ramawat (Eds.). Springer, Cham,
Switzerland
Gupta
S, A Dubey, T Singh (2017). Curvularia lunata as, a dominant seed-borne pathogen in Dalbergia
sissoo Roxb: Its location in
seed and its phytopathological effects. Afr J Plant Sci 11:203208
Helal RB, S Hosen, S Shamsi (2018). Mycoflora associated with post-harvest disease of papaya (Carica
papaya L.) and their pathogenic
potentiality. Bangl J Bot 47:389395
Janbozorgi S, M Mehrabi-Koushki, R Farokhinejad (2019). New records and hosts of the Curvularia
species in Iran. Rostaniha 20:113
Jinfeng
EC, MIM Rafi, KC Hoon, HK Lian, CY Kqueen (2017). Analysis of chemical
constituents, antimicrobial and anticancer activities of dichloromethane
extracts of Sordariomycetes spp. endophytic fungi isolated from Strobilanthes
crispus. World
J Microbiol Biotechnol 33:524
Kiss
N, M Homa, P Manikandan, A Mythili, K Krizsan, R
Revathi, S Kocsube (2020). New species of the genus Curvularia: C. tamilnaduensis and C. coimbatorensis from fungal keratitis cases in South India. Pathogens 2020; Article 9
Kusai
NA, MMZ Azmi, S Zulkifly, MT Yusof, NAIM Zainudin (2016). Morphological and
molecular characterization of Curvularia and related species associated with leaf spot disease of
rice in Peninsular Malaysia. Rendic
Linc 27:205214
Kuyu CG, YB Tola (2018). Assessment of banana fruit
handling practices and associated fungal pathogens in Jimma town market,
southwest Ethiopia. Food Sci Nutr 6:609616
Liu
Z, T Liu, D Chen, J Hou (2019). First report of Curvularia
lunata causing leaf spots on Partridge tea [Mallotus oblongifolius
(Miq.) Mull. Arg.] in
China. J Plant Pathol 101:439439
Lu
Y, Y Song, Z Xue (2019). Multiplex polymerase chain reaction detection of Curvularia
lunata, Bipolaris maydis, and Aureobasidium zeae in infected maize leaf tissues. J
Basic Microbiol 59:862866
Majumdar
N, NC Mandal (2019). Screening of different botanicals
extract on two polyphagous postharvest pathogens from mango and banana. J
Pharmacogn Phytochem 8:42534256
Memon IN, H Wagan, S Noonari, MH Lakhio, BA Lanjar (2016). Economic analysis of banana production
under contract farming in Sindh, Pakistan. J
Market Consum Res 21:1421
Moslemi
A, PK Ades, T Groom, ME Nicolas, PW Taylor (2017). Alternaria
infectoria and Stemphylium
herbarum, two new pathogens
of pyrethrum (Tanacetum cinerariifolium) in Australia.
Aust
Plant Pathol 46:91101
Pei
YL, S Tao, YF Sun, TZ Feng, HB Long (2018). First report of Capsicum
frutescens leaf spot caused by Curvularia lunata in China. Plant
Dis 102:241241
Pornsuriya
C, SI Ito, A Sunpapao (2018). First
report of leaf spot on lettuce caused by Curvularia aeria. J
Gen Plant Pathol 84:296299
Raza
M, ZF Zhang, KD Hyde, YZ Diao, L Cai (2019).
Culturable plant pathogenic fungi associated with sugarcane in southern China. Fung
Divers 99:1104
Rehman
A, Z Deyuan, I Hussain, MS Iqbal, Y Yang, L Jingdong (2018). Prediction
of major agricultural fruits production in Pakistan by using an econometric
analysis and machine learning technique. Intl
J Fruit Sci 18:445461
Santos PRRD, EU Leao, RWDS Aguiar, MPD Melo, GRD Santos
(2018). Morphological
and molecular characterization of Curvularia lunata pathogenic to
andropogon grass. Bragantia 77:326332
Selvaraj
MG, A Vergara, H Ruiz, N Safari, S Elayabalan, W Ocimati, G Blomme (2019). Al-powered banana diseases and pest detection. Plant
Meth 15:92
Shen
Z, CR Penton, N Lv, C Xue, X Yuan, Y Ruan, Q Shen (2018). Banana Fusarium wilt
disease incidence is influenced by shifts of soil microbial communities under
different monoculture spans. Microb Ecol 75:739750
Silva
AO, DC Savi, FB Gomes, FMWR Gos, GJ Silva, C Glienke (2017). Identification of Colletotrichum species associated with postbloom fruit drop in Brazil
through GAPDH sequencing analysis and multiplex PCR. Eur
J Plant Pathol 147:731748
Tamura K, FU
Battistuzzi, P Billing-Ross, O Murillo, A Filipski, S
Kumar (2012). Estimating divergence times in large molecular
phylogenies. Proc Natl Acad Sci USA
109:1933319338
Thompson JD, DG
Higgins, TJ Gibson (1994). CLUSTAL W: Improving the sensitivity of progressive
multiple sequence alignment through sequence weighting, position specific gap
penalties and weight matrix choice. Nucl Acids Res
22:46734680
Varma
V, DP Bebber (2019). Climate change impacts on banana yields around the world. Nat
Clim Change 9:752757
Vilaplana
R, L Pazmino, S Valencia-Chamorro (2018). Control of
anthracnose, caused by Colletotrichum musae, on postharvest organic
banana by thyme oil. Postharv
Biol Technol 138:5663
Wang
H, L Xu, Z Zhang, J Lin, X Huang (2019). First report of Curvularia
pseudobrachyspora causing leaf spots in Areca catechu in China.
Plant
Dis 103:150153
Wurzbacher C, E Larsson, J Bengtsson-Palme, SV den Wyngaert, S Svantesson, E Kristiansson, RH Nilsson (2019). Introducing ribosomal tandem repeat
barcoding for fungi. Mol Ecol Res 19:118127
Xu
G, F Zheng, R Ma, FQ Zheng, L Zheng, XF Ding, CP Xie (2018). First
report of Curvularia lunata causing leaf spot of Pennisetum hydridum
in China. Plant Dis 102:23722372
Zhang
W, JX Liu, PH Huo, ZB Nan (2017). Curvularia lunata causes a leaf spot on carpetgrass (Axonopus
compressus) in China. Plant
Dis 101:507